Top » Catalog » SNPs » FGC23339

$18.00

FGC23339
[FGC23339]

FGC23339
hg38 Position: ChrY:21459116..21459116
Ancestral: C
Derived: T
Reference: George Chandler (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23339_F CCTTACTACCACACAGTACCTGACAC
Reverse Primer: FGC23339_R GATGTAAGCAAATAATTATGGCTTCC
Reviews

Customers who bought this product also purchased
FGC33265
FGC33265
FGC39789
FGC39789
FGC39788
FGC39788
FGC39790
FGC39790
FGC17906
FGC17906
FGC33267
FGC33267
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies