Top » Catalog » SNPs » FGC23339

$18.00

FGC23339
[FGC23339]

FGC23339
hg38 Position: ChrY:21459116..21459116
Ancestral: C
Derived: T
Reference: George Chandler (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23339_F CCTTACTACCACACAGTACCTGACAC
Reverse Primer: FGC23339_R GATGTAAGCAAATAATTATGGCTTCC
Reviews

Customers who bought this product also purchased
FGC33267
FGC33267
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
FGC33265
FGC33265
FGC39789
FGC39789
FGC39788
FGC39788
FGC39790
FGC39790
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies