Top » Catalog » SNPs » FGC23331

$18.00

FGC23331
[FGC23331]

FGC23331
hg38 Position: ChrY:8710211..8710211
Ancestral: G
Derived: C
Reference: George Chandler (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23331_F TGAGCCATTGTGTGGATTTC
Reverse Primer: FGC23331_R ATGCCCGTGTTTCATATTCC
Reviews

Customers who bought this product also purchased
FGC39789
FGC39789
FGC39788
FGC39788
FGC39790
FGC39790
FGC17906
FGC17906
FGC33267
FGC33267
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies