Top » Catalog » SNPs » FGC23335

$18.00

FGC23335
[FGC23335]

FGC23335
hg38 Position: ChrY:16060918..16060918
Ancestral: G
Derived: C
Reference: George Chandler (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23335_F GCATTGATGGAATTTTGTTCC
Reverse Primer: FGC23335_R ATACAGTTGTTTGCCTAAATGCC
Reviews

Customers who bought this product also purchased
FGC39788
FGC39788
FGC39790
FGC39790
FGC17906
FGC17906
FGC33267
FGC33267
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
FGC33265
FGC33265
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies