Top » Catalog » SNPs » FGC23337

$18.00

FGC23337
[FGC23337]

FGC23337
hg38 Position: ChrY:20937326..20937326
Ancestral: A
Derived: G
Reference: George Chandler (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC23337vl_F TGCTTACAAGAAACCCTTTGAC
Reverse Primer: FGC23337vl_R CCACGTTTGTCTAGTTTCTAAGTTTG
Reviews

Customers who bought this product also purchased
FGC39789
FGC39789
FGC39788
FGC39788
FGC39790
FGC39790
FGC17906
FGC17906
FGC33267
FGC33267
R1b-S1051 Henry Panel
R1b-S1051 Henry Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies