Top » Catalog » SNPs » A77

$19.00

A77
[A77]

A77
hg38 Position: ChrY:11928656..11928656
Ancestral: G
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1g (not listed)
Comments: Found in a R1b-DF21 person
Forward Primer: A77_F GAATGCCCCCTGTGTCATC
Reverse Primer: A77_R CACTGCGCAATCTGTCTAGG
Reviews
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies