Top » Catalog » SNPs » L53

$18.00

L53
[L53]

L53
hg38 Position: ChrY:19480410..19480410
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a
Comments: .
Forward Primer: L53_F TTCTGGCTGGCAATATCCTC
Reverse Primer: L53_R TCCTGCTATTTCTGTTTTGTGTG
Reviews

Customers who bought this product also purchased
YP4064
YP4064
M1107
M1107
YP4025
YP4025
L334
L334
L54
L54
L804
L804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies