Top » Catalog » SNPs » L53

$18.00

L53
[L53]

L53
hg38 Position: ChrY:19480410..19480410
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a
Comments: .
Forward Primer: L53_F TTCTGGCTGGCAATATCCTC
Reverse Primer: L53_R TCCTGCTATTTCTGTTTTGTGTG
Reviews

Customers who bought this product also purchased
JN13
JN13
Y7582
Y7582
A13506
A13506
M3
M3
YP5097
YP5097
FGC6925
FGC6925
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies