Top » Catalog » SNPs » L53

$18.00

L53
[L53]

L53
hg38 Position: ChrY:19480410..19480410
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a
Comments: .
Forward Primer: L53_F TTCTGGCTGGCAATATCCTC
Reverse Primer: L53_R TCCTGCTATTTCTGTTTTGTGTG
Reviews

Customers who bought this product also purchased
BZ4523
BZ4523
L527
L527
L932
L932
BZ4515
BZ4515
M242
M242
FGC6986
FGC6986
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies