Top » Catalog » SNPs » L53

$18.00

L53
[L53]

L53
hg38 Position: ChrY:19480410..19480410
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a
Comments: .
Forward Primer: L53_F TTCTGGCTGGCAATATCCTC
Reverse Primer: L53_R TCCTGCTATTTCTGTTTTGTGTG
Reviews

Customers who bought this product also purchased
Q1b-L53 Panel
Q1b-L53 Panel
Z5906
Z5906
CTS2731
CTS2731
Z5908
Z5908
L890
L890
M925
M925
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies