Top » Catalog » SNPs » L53

$18.00

L53
[L53]

L53
hg38 Position: ChrY:19480410..19480410
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2a
Comments: .
Forward Primer: L53_F TTCTGGCTGGCAATATCCTC
Reverse Primer: L53_R TCCTGCTATTTCTGTTTTGTGTG
Reviews

Customers who bought this product also purchased
YP779
YP779
M242
M242
BY119734
BY119734
Z5908
Z5908
Z19432
Z19432
BZ3477
BZ3477
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies