Top » Catalog » SNPs » L56

$18.00

L56
[L56]

L56
hg38 Position: ChrY:8280828..8280828
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2
Comments: .
Forward Primer: L56_F TAGGAGGGCAGCTTGTTTTG
Reverse Primer: L56_R GAATCGCTGTGGGTTAAAGG
Reviews

Customers who bought this product also purchased
M848
M848
BY49212
BY49212
Y788
Y788
Y27993
Y27993
Q1b-L53 Panel
Q1b-L53 Panel
Y202475
Y202475
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies