Top » Catalog » SNPs » L56

$18.00

L56
[L56]

L56
hg38 Position: ChrY:8280828..8280828
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2
Comments: .
Forward Primer: L56_F TAGGAGGGCAGCTTGTTTTG
Reverse Primer: L56_R GAATCGCTGTGGGTTAAAGG
Reviews

Customers who bought this product also purchased
Z5906
Z5906
CTS2731
CTS2731
Z5908
Z5908
L890
L890
M925
M925
Y788
Y788
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies