Top » Catalog » SNPs » L56

$18.00

L56
[L56]

L56
hg38 Position: ChrY:8280828..8280828
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2
Comments: .
Forward Primer: L56_F TAGGAGGGCAGCTTGTTTTG
Reverse Primer: L56_R GAATCGCTGTGGGTTAAAGG
Reviews

Customers who bought this product also purchased
M3
M3
Y16138
Y16138
M930
M930
Y9291
Y9291
M1107
M1107
JN13
JN13
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies