Top » Catalog » SNPs » L56

$18.00

L56
[L56]

L56
hg38 Position: ChrY:8280828..8280828
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2
Comments: .
Forward Primer: L56_F TAGGAGGGCAGCTTGTTTTG
Reverse Primer: L56_R GAATCGCTGTGGGTTAAAGG
Reviews

Customers who bought this product also purchased
L932
L932
BZ4515
BZ4515
L54
L54
FGC6986
FGC6986
BZ4502
BZ4502
YP779
YP779
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies