Top » Catalog » SNPs » L56

$18.00

L56
[L56]

L56
hg38 Position: ChrY:8280828..8280828
Ancestral: G
Derived: A
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: Q1a2
Comments: .
Forward Primer: L56_F TAGGAGGGCAGCTTGTTTTG
Reverse Primer: L56_R GAATCGCTGTGGGTTAAAGG
Reviews

Customers who bought this product also purchased
M1107
M1107
JN13
JN13
FGC6925
FGC6925
Y7582
Y7582
A13506
A13506
L804
L804
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies