Top » Catalog » SNPs » M1107

$18.00

M1107
[M1107]

M1107
hg38 Position: ChrY:13090695..13090695
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: Q1a2a1 (not listed)
Comments: Below L54 & peer to L334
Forward Primer: M1107_F TTTTTGAGACAGTTTTCCTCTTG
Reverse Primer: M1107_R TGACTAAGAACAGGTTATGATAGGG
Reviews

Customers who bought this product also purchased
M242
M242
FGC6986
FGC6986
BZ4502
BZ4502
YP779
YP779
L940
L940
BZ1493
BZ1493
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies