Top » Catalog » SNPs » M1107

$18.00

M1107
[M1107]

M1107
hg38 Position: ChrY:13090695..13090695
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: Q1a2a1 (not listed)
Comments: Below L54 & peer to L334
Forward Primer: M1107_F TTTTTGAGACAGTTTTCCTCTTG
Reverse Primer: M1107_R TGACTAAGAACAGGTTATGATAGGG
Reviews

Customers who bought this product also purchased
M3
M3
YP5097
YP5097
FGC6925
FGC6925
Y16138
Y16138
L275
L275
Y9291
Y9291
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies