Top » Catalog » SNPs » M1107

$18.00

M1107
[M1107]

M1107
hg38 Position: ChrY:13090695..13090695
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: Q1a2a1 (not listed)
Comments: Below L54 & peer to L334
Forward Primer: M1107_F TTTTTGAGACAGTTTTCCTCTTG
Reverse Primer: M1107_R TGACTAAGAACAGGTTATGATAGGG
Reviews

Customers who bought this product also purchased
Y16138
Y16138
L275
L275
Y9291
Y9291
L56
L56
JN13
JN13
Q Superclade Panel
Q Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies