Top » Catalog » SNPs » M930

$18.00

M930
[M930]

M930
hg38 Position: ChrY:21229412..21229412
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: Q1a2a1a
Comments: Below L53 > L54 > M1107 & peer to Z780/M971
Forward Primer: M930_F TTTTGTAAACTGATTTTCGTTACCTTG
Reverse Primer: M930_R GCACGTTCTCCTCAAAAGC
Reviews

Customers who bought this product also purchased
FGC6925
FGC6925
L275
L275
L56
L56
Y9291
Y9291
Q Superclade Panel
Q Superclade Panel
Y7582
Y7582
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies