Top » Catalog » SNPs » M930

$18.00

M930
[M930]

M930
hg38 Position: ChrY:21229412..21229412
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: Q1a2a1a
Comments: Below L53 > L54 > M1107 & peer to Z780/M971
Forward Primer: M930_F TTTTGTAAACTGATTTTCGTTACCTTG
Reverse Primer: M930_R GCACGTTCTCCTCAAAAGC
Reviews

Customers who bought this product also purchased
BZ2870
BZ2870
BZ4523
BZ4523
L527
L527
L932
L932
BZ4515
BZ4515
M242
M242
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies