Top » Catalog » SNPs » M930

$18.00

M930
[M930]

M930
hg38 Position: ChrY:21229412..21229412
Ancestral: T
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: Q1a2a1a
Comments: Below L53 > L54 > M1107 & peer to Z780/M971
Forward Primer: M930_F TTTTGTAAACTGATTTTCGTTACCTTG
Reverse Primer: M930_R GCACGTTCTCCTCAAAAGC
Reviews

Customers who bought this product also purchased
Y16138
Y16138
YP5097
YP5097
M848
M848
Q1b-L53 Panel
Q1b-L53 Panel
Y18503
Y18503
A13506
A13506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A426
1 x A720
$36.00
Haplogroup Info
Other products
Currencies