Top » Catalog » SNPs » A88

$18.00

A88
[A88]

A88
hg38 Position: ChrY:16273027..16273027
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1c1b1a2a1
Comments: Found in a R1b-CTS4466 person
Forward Primer: A88_F GAAGGATGGAAGAAGCTTGG
Reverse Primer: A88_R GCAGGATGGGCATGTAGG
Reviews

Customers who bought this product also purchased
A12591
A12591
A12588
A12588
A12596
A12596
A11843
A11843
A12594
A12594
R1b-A761 Panel
R1b-A761 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies