Top » Catalog » SNPs » YP728

$18.00

YP728
[YP728]

YP728
hg38 Position: ChrY:7339125..7339125
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: R1a1a1b1a1b1c (not listed)
Comments: M458 > L1029 > YP417 > YP418
Forward Primer: YP728_F CCTTAGCCTCCCAAAGTATTGA
Reverse Primer: YP728_R CAAAAAGCAAGTTCCATAGAGCC
Reviews

Customers who bought this product also purchased
YP5081
YP5081
Y91231
Y91231
Y96582
Y96582
M458
M458
YSEQ-Delta
YSEQ-Delta
Y81086
Y81086
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies