Top » Catalog » SNPs » YP728

$18.00

YP728
[YP728]

YP728
hg38 Position: ChrY:7339125..7339125
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: R1a1a1b1a1b1c (not listed)
Comments: M458 > L1029 > YP417 > YP418
Forward Primer: YP728_F CCTTAGCCTCCCAAAGTATTGA
Reverse Primer: YP728_R CAAAAAGCAAGTTCCATAGAGCC
Reviews

Customers who bought this product also purchased
Y37930
Y37930
YP592
YP592
YP6047
YP6047
Y18348
Y18348
A14777
A14777
A14776
A14776
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies