Top » Catalog » SNPs » YP728

$18.00

YP728
[YP728]

YP728
hg38 Position: ChrY:7339125..7339125
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: R1a1a1b1a1b1c (not listed)
Comments: M458 > L1029 > YP417 > YP418
Forward Primer: YP728_F CCTTAGCCTCCCAAAGTATTGA
Reverse Primer: YP728_R CAAAAAGCAAGTTCCATAGAGCC
Reviews

Customers who bought this product also purchased
Y42120
Y42120
Y28874
Y28874
Y42176
Y42176
Y144485
Y144485
BY30629
BY30629
YP5081
YP5081
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies