Top » Catalog » SNPs » YP728

$18.00

YP728
[YP728]

YP728
hg38 Position: ChrY:7339125..7339125
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: R1a1a1b1a1b1c (not listed)
Comments: M458 > L1029 > YP417 > YP418
Forward Primer: YP728_F CCTTAGCCTCCCAAAGTATTGA
Reverse Primer: YP728_R CAAAAAGCAAGTTCCATAGAGCC
Reviews

Customers who bought this product also purchased
M438
M438
M12
M12
V13
V13
Y133361
Y133361
M343
M343
CTS1211
CTS1211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies