Top » Catalog » SNPs » YP728

$18.00

YP728
[YP728]

YP728
hg38 Position: ChrY:7339125..7339125
Ancestral: G
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: R1a1a1b1a1b1c (not listed)
Comments: M458 > L1029 > YP417 > YP418
Forward Primer: YP728_F CCTTAGCCTCCCAAAGTATTGA
Reverse Primer: YP728_R CAAAAAGCAAGTTCCATAGAGCC
Reviews

Customers who bought this product also purchased
Y139228
Y139228
Y39054
Y39054
A27236
A27236
BY82741
BY82741
Y70897
Y70897
FT104863
FT104863
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies