Top » Catalog » SNPs » FGC23592

$18.00

FGC23592
[FGC23592]

FGC23592
hg38 Position: ChrY:7442948..7442948
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2b1
Comments: Below S603
Forward Primer: FGC23592v2_F GGAACCAGATAGCAGTGGCA
Reverse Primer: FGC23592v2_R TTGAAGACTGGGCCTTGTTC
Reviews

Customers who bought this product also purchased
A11307
A11307
FGC62850
FGC62850
A9886
A9886
F1265
F1265
A10535
A10535
Y111067
Y111067
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies