Top » Catalog » SNPs » FGC23592

$18.00

FGC23592
[FGC23592]

FGC23592
hg38 Position: ChrY:7442948..7442948
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a2b1
Comments: Below S603
Forward Primer: FGC23592v2_F GGAACCAGATAGCAGTGGCA
Reverse Primer: FGC23592v2_R TTGAAGACTGGGCCTTGTTC
Reviews

Customers who bought this product also purchased
FGC10147
FGC10147
A10629
A10629
A5386
A5386
Y9391
Y9391
FGC10138
FGC10138
Y81784
Y81784
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies