Top » Catalog » SNPs » FGC5496

$18.00

FGC5496
[FGC5496]

FGC5496
hg38 Position: ChrY:7438680..7438680
Ancestral: A
Derived: G
Reference: Full Genomes Inc (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1l1
Comments: Found in a R-DF13 person. below FGC5494
Forward Primer: FGC5496v2_F GGTGCCCAACATCACTAATTG
Reverse Primer: FGC5496v2_R GCACAGTGGCATGGTCTTG
Reviews (1)

Customers who bought this product also purchased
Y230065
Y230065
Y230064
Y230064
BY7806
BY7806
Y18844
Y18844
S1105
S1105
BY203693
BY203693
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies