Top » Catalog » SNPs » FGC12305

$18.00

FGC12305
[FGC12305]

FGC12305
hg38 Position: ChrY:17439461..17439461
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c2a (not listed)
Comments: Downstream of DF89
Forward Primer: FGC12305v2_F CAACAGGACACAGAAGCAAATG
Reverse Primer: FGC12305v2_R GTCATACCACAAAATGCCAGG
Reviews

Customers who bought this product also purchased
S1688
S1688
JFS0006
JFS0006
S15627
S15627
U106
U106
DF96
DF96
DF93
DF93
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies