Top » Catalog » SNPs » FGC12305

$18.00

FGC12305
[FGC12305]

FGC12305
hg38 Position: ChrY:17439461..17439461
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c2a (not listed)
Comments: Downstream of DF89
Forward Primer: FGC12305v2_F CAACAGGACACAGAAGCAAATG
Reverse Primer: FGC12305v2_R GTCATACCACAAAATGCCAGG
Reviews

Customers who bought this product also purchased
DF89
DF89
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
Z301
Z301
S15627
S15627
U106
U106
DF96
DF96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies