Top » Catalog » SNPs » FGC12305

$18.00

FGC12305
[FGC12305]

FGC12305
hg38 Position: ChrY:17439461..17439461
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b1a2a1a1c2a (not listed)
Comments: Downstream of DF89
Forward Primer: FGC12305v2_F CAACAGGACACAGAAGCAAATG
Reverse Primer: FGC12305v2_R GTCATACCACAAAATGCCAGG
Reviews

Customers who bought this product also purchased
FGC12309
FGC12309
FT3093
FT3093
M343
M343
JFS0004
JFS0004
JFS0026
JFS0026
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies