Top » Catalog » SNPs » FGC12307

$18.00

FGC12307
[FGC12307]

FGC12307
hg38 Position: ChrY:8191403..8191403
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U198 > FGC12305
Forward Primer: FGC12307_F TTCCTTCTACTTATACAGCTTATGTTGC
Reverse Primer: FGC12307_R TTTCAAAGAAAATACAATGCCTAAAC
Reviews

Customers who bought this product also purchased
S1687
S1687
Z2103
Z2103
JFS0026
JFS0026
L51
L51
JFS0029
JFS0029
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies