Top » Catalog » SNPs » FGC12307

$18.00

FGC12307
[FGC12307]

FGC12307
hg38 Position: ChrY:8191403..8191403
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U198 > FGC12305
Forward Primer: FGC12307_F TTCCTTCTACTTATACAGCTTATGTTGC
Reverse Primer: FGC12307_R TTTCAAAGAAAATACAATGCCTAAAC
Reviews

Customers who bought this product also purchased
Y28669
Y28669
JFS0006
JFS0006
Z156
Z156
L21
L21
BY16501
BY16501
P312
P312
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies