Top » Catalog » SNPs » S16994

$18.00

S16994
[S16994]

S16994
hg38 Position: ChrY:13211355..13211355
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1c2a (not listed)
Comments: Comprises the third branch of R-U198
Forward Primer: S16994_F TCCAGATCCAAGAGCATTCC
Reverse Primer: S16994_R GCCTGCCTGAAAATCACAG
Reviews (2)

Customers who bought this product also purchased
Z381
Z381
S1687
S1687
L48
L48
S1686
S1686
Z18
Z18
DF96
DF96
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies