Top » Catalog » SNPs » Z26414

$18.00

Z26414
[Z26414]

Z26414
hg38 Position: ChrY:15110540..15110540
Ancestral: G
Derived: C
Reference: Ray Banks (2014)
ISOGG Haplogroup: G2a2b2a1a1c1a1b1
Comments: Below Z3428
Forward Primer: Z26414_F CCATGCTGGGAGAATTATTGG
Reverse Primer: Z26414_R TAGCCAAGGGAAGCCACA
Reviews

Customers who bought this product also purchased
U1
U1
CTS7045
CTS7045
FGC37667
FGC37667
Z43844
Z43844
FGC37658
FGC37658
FGC37729
FGC37729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies