Top » Catalog » SNPs » A1301

$18.00

A1301
[A1301]

A1301
hg38 Position: ChrY:18882639..18882639
Ancestral: A
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1301_F TGGCTTGTTTAGCCATCTCC
Reverse Primer: A1301_R TCAAAGTGTGATGGAGTTTCTAGG
Reviews

Customers who bought this product also purchased
FGC19915
FGC19915
BY1474
BY1474
L1314
L1314
A7757
A7757
A7254
A7254
A6368
A6368
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies