Top » Catalog » SNPs » A1302

$18.00

A1302
[A1302]

A1302
hg38 Position: ChrY:18989285..18989285
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1302_F GGGAACACTGAGAACCAAGC
Reverse Primer: A1302_R GGATCATTGGAATGCATGTG
Reviews

Customers who bought this product also purchased
A1297
A1297
A1304
A1304
A1149
A1149
A1293
A1293
A1303
A1303
A1148
A1148
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies