Top » Catalog » SNPs » A1302

$18.00

A1302
[A1302]

A1302
hg38 Position: ChrY:18989285..18989285
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1302_F GGGAACACTGAGAACCAAGC
Reverse Primer: A1302_R GGATCATTGGAATGCATGTG
Reviews

Customers who bought this product also purchased
A1303
A1303
A1148
A1148
A1292
A1292
A1301
A1301
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1291
A1291
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies