Top » Catalog » SNPs » A1304

$18.00

A1304
[A1304]

A1304
hg38 Position: ChrY:19572800..19572800
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1304_F AAGCAGTGCATGGGAACTATG
Reverse Primer: A1304_R AACCAACAGCACAACTTCCAG
Reviews

Customers who bought this product also purchased
A1289
A1289
A1297
A1297
A1303
A1303
A1149
A1149
A1293
A1293
A1302
A1302
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies