Top » Catalog » SNPs » A1308

$18.00

A1308
[A1308]

A1308
hg38 Position: ChrY:21445073..21445073
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1308_F GAAACAATAATGTTGTGAAACCAGG
Reverse Primer: A1308_R CATTGCTGGTGTTTTACCCG
Reviews

Customers who bought this product also purchased
A1148
A1148
A1292
A1292
A1301
A1301
R1b-FGC5494-z450611
R1b-FGC5494-z450611
A1291
A1291
A1299
A1299
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies