Top » Catalog » SNPs » M7884

$18.00

M7884
[M7884]

M7884
hg38 Position: ChrY:19620023..19620023
Ancestral: G
Derived: A
Reference: Underhill et al.
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: .
Forward Primer: M7884_F CCAGCAGCTTTTCTTCATCC
Reverse Primer: M7884_R TCAGGACAATATGCCTGATG
Reviews

Customers who bought this product also purchased
L1444
L1444
BY211577
BY211577
Z17653
Z17653
FT416429
FT416429
Z16502
Z16502
Y96923
Y96923
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FTB15831
$18.00
Haplogroup Info
Other products
Currencies