Top » Catalog » SNPs » Z17653

$18.00

Z17653
[Z17653]

Z17653
hg38 Position: ChrY:20883659..20883659
Ancestral: T
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of Z16502
Forward Primer: Z17653_F TCAGAAGTTTGAGACCAAGACG
Reverse Primer: Z17653_R GGAGGAGTTTTGTTGAAGAAGG
Reviews

Customers who bought this product also purchased
BY132127
BY132127
FGC61834
FGC61834
Y96923
Y96923
L1444
L1444
FGC61842
FGC61842
M7884
M7884
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies