Top » Catalog » SNPs » A1286

$18.00

A1286
[A1286]

A1286
hg38 Position: ChrY:16650775..16650775
Ancestral: T
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1286_F TCTAGAAAACATTTTTATAACCGATGATAC
Reverse Primer: A1286_R ACAAGACAACATTTCTCCTGTCAG
Reviews

Customers who bought this product also purchased
A1285
A1285
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies