Top » Catalog » SNPs » PF2546

$18.00

PF2546
[PF2546]

PF2546
hg38 Position: ChrY:18902181..18902181
Ancestral: T
Derived: A
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: E1b1b1b1a1
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF2546_F CACAATGCCATGAGCAAAAG
Reverse Primer: PF2546_R TTTGGCGTCTGTGTTCATTC
Reviews

Customers who bought this product also purchased
MZ284
MZ284
DNA Sample Kit
DNA Sample Kit
BY9749
BY9749
MZ151
MZ151
MZ244
MZ244
BY10233
BY10233
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies