Top » Catalog » SNPs » CTS11962

$18.00

CTS11962
[CTS11962]

CTS11962
hg38 Position: ChrY:21221843..21221843
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1a1a1b1a1b
Comments: Syn. with CTS11962; downstream M458
Forward Primer: CTS11962_F AACTTGTCCTTTGGCTCCTG
Reverse Primer: CTS11962_R ATGGAAGCCTGCAAATGTTC
Reviews

Customers who bought this product also purchased
YP515
YP515
Z93
Z93
R1a Superclade Panel
R1a Superclade Panel
YP1182
YP1182
YP1337
YP1337
YP254
YP254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies