Top » Catalog » SNPs » M458

$18.00

M458
[M458]

M458
hg38 Position: ChrY:22220317..22220317
Ancestral: A
Derived: G
Reference: Underhill et al. 2009
ISOGG Haplogroup: R1a1a1b1a1
Comments: .
Forward Primer: M458_F AAAGAGACCAGAAAGAAGAGATTTCTAG
Reverse Primer: M458_R CCTGGGGTAGAAAATTATTGGTC
Reviews

Customers who bought this product also purchased
A19325
A19325
DYS576
DYS576
BY30698
BY30698
DYS626
DYS626
BY207879
BY207879
Y107244
Y107244
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies