Top » Catalog » SNPs » M458

$19.00

M458
[M458]

M458
hg38 Position: ChrY:22220317..22220317
Ancestral: A
Derived: G
Reference: Underhill et al. 2009
ISOGG Haplogroup: R1a1a1b1a1
Comments: .
Forward Primer: M458_F AAAGAGACCAGAAAGAAGAGATTTCTAG
Reverse Primer: M458_R CCTGGGGTAGAAAATTATTGGTC
Reviews

Customers who bought this product also purchased
FT77501
FT77501
Z2463
Z2463
Z649
Z649
Z2914
Z2914
Y15121
Y15121
FTA69629
FTA69629
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies