Top » Catalog » SNPs » M458

$18.00

M458
[M458]

M458
hg38 Position: ChrY:22220317..22220317
Ancestral: A
Derived: G
Reference: Underhill et al. 2009
ISOGG Haplogroup: R1a1a1b1a1
Comments: .
Forward Primer: M458_F AAAGAGACCAGAAAGAAGAGATTTCTAG
Reverse Primer: M458_R CCTGGGGTAGAAAATTATTGGTC
Reviews

Customers who bought this product also purchased
Z4624
Z4624
Y72918
Y72918
YP258
YP258
Y184194
Y184194
YP4999
YP4999
YP1506
YP1506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies