Top » Catalog » SNPs » M458

$18.00

M458
[M458]

M458
hg38 Position: ChrY:22220317..22220317
Ancestral: A
Derived: G
Reference: Underhill et al. 2009
ISOGG Haplogroup: R1a1a1b1a1
Comments: .
Forward Primer: M458_F AAAGAGACCAGAAAGAAGAGATTTCTAG
Reverse Primer: M458_R CCTGGGGTAGAAAATTATTGGTC
Reviews

Customers who bought this product also purchased
YP6516
YP6516
YP5820
YP5820
SK2014
SK2014
Y4382
Y4382
Y4380
Y4380
A22777
A22777
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies