Top » Catalog » SNPs » M458

$18.00

M458
[M458]

M458
hg38 Position: ChrY:22220317..22220317
Ancestral: A
Derived: G
Reference: Underhill et al. 2009
ISOGG Haplogroup: R1a1a1b1a1
Comments: .
Forward Primer: M458_F AAAGAGACCAGAAAGAAGAGATTTCTAG
Reverse Primer: M458_R CCTGGGGTAGAAAATTATTGGTC
Reviews

Customers who bought this product also purchased
Y37285
Y37285
DYS518
DYS518
DYS385
DYS385
Y166625
Y166625
DYS449
DYS449
DYS570
DYS570
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies