Top » Catalog » SNPs » Z27131

$18.00

Z27131
[Z27131]

Z27131
hg38 Position: ChrY:7036991..7036991
Ancestral: C
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z16988
Forward Primer: Z27131_F AATGGGAATGCAGGCTTATG
Reverse Primer: Z27131_R ATGTCATGCCCTCCTAGACG
Reviews

Customers who bought this product also purchased
BY155589
BY155589
BY50887
BY50887
BY124165
BY124165
V13
V13
BY153593
BY153593
F14488
F14488
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies