Top » Catalog » SNPs » YFS287700

$18.00

YFS287700
[YFS287700]

YFS287700
hg38 Position: ChrY:2837579..2837579
Ancestral: A
Derived: G
Reference: Stephen Goodrich (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below Z16242/A160
Forward Primer: YFS287700_F CATTCAACTGCAAACTCCAGG
Reverse Primer: YFS287700_R AGCACCTGCACCCACTG
Reviews

Customers who bought this product also purchased
FGC14566
FGC14566
YFS287725
YFS287725
FGC14554
FGC14554
FGC19295
FGC19295
YFS287772
YFS287772
FGC14560
FGC14560
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies